Mouse Gusb activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Gusb
Locus ID	110006
Kit Components	GA212271G1, Gusb gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGAGTTTGTTATTAAAGCC GA212271G2, Gusb gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTTAGCCTAGTGGTCCTGA GA212271G3, Gusb gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTTGCCCCTCAGGACCACT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_010368, NM_001357025, NM_001357026, NM_001357027
Synonyms	AI747421; asd; g; Gur; Gus; Gus-r; Gus-s; Gus-t; Gus-u; Gut
Summary	Plays an important role in the degradation of dermatan and keratan sulfates.[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.