Mouse Malat1 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Malat1
Locus ID	72289
Kit Components	GA209185G1, Malat1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGATTTTTCTTGACGTCGTG GA209185G2, Malat1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTCTTCCTTCACCAAGGTGG GA209185G3, Malat1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAAGGGACACGTCACTCCAC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NR_002847
Summary	This gene produces a long non-coding RNA that is cleaved into a mature, functional transcript as well as a small cytoplasmic RNA (mascRNA). The mature transcript is stabilized by a 3' triple helical structure and is retained in the nucleus. This transcript functions in the regulation of gene expression and proliferation and may be upregulated in tumors. [provided by RefSeq, Nov 2016]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.