Mouse Muc5ac activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Muc5ac
Locus ID	17833
Kit Components	GA202762G1, Muc5ac gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGTCATTTCAGGCTAGTCAA GA202762G2, Muc5ac gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGAGTGGCCACTGTTTACCT GA202762G3, Muc5ac gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCCACCCACGTGAAGTCACT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_010844
Synonyms	2210005L13Rik; MGM

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.