Mouse Ascl1 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Ascl1
Locus ID	17172
Kit Components	GA202576G1, Ascl1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGGAGGGAGCTGAGGAGGT GA202576G2, Ascl1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGAAGAGGAGGGGTAGTGG GA202576G3, Ascl1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGGTGCGGCCGCCTTTTCAA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_008553
Synonyms	AI225900; ASH1; bHLHa46; Mash1
Summary	Transcription factor that plays a key role in neuronal differentiation: acts as a pioneer transcription factor, accessing closed chromatin to allow other factors to bind and activate neural pathways (PubMed:24243019). Directly binds the E box motif (5'-CANNTG-3') on promoters and promotes transcription of neuronal genes (PubMed:20107439, PubMed:24243019, PubMed:27281220). The combination of three transcription factors, ASCL1, POU3F2/BRN2 and MYT1L, is sufficient to reprogram fibroblasts and other somatic cells into induced neuronal (iN) cells in vitro (PubMed:20107439, PubMed:24243019, PubMed:27281220). Plays a role at early stages of development of specific neural lineages in most regions of the CNS, and of several lineages in the PNS (PubMed:8217843). Essential for the generation of olfactory and autonomic neurons (PubMed:8221886). Acts synergistically with FOXN4 to specify the identity of V2b neurons rather than V2a from bipotential p2 progenitors during spinal cord neurogenesis, probably through DLL4-NOTCH signaling activation (PubMed:16020526, PubMed:17728344).[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.