Mouse Gata3 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Gata3
Locus ID	14462
Kit Components	GA201553G1, Gata3 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTAAAGGGGTGCTACTGCGC GA201553G2, Gata3 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAGTCTTAACTGGAGGAAGT GA201553G3, Gata3 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GACTTTTGGGAGCAATGACG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_008091, NM_001355110, NM_001355111, NM_001355112
Synonyms	Gata-3; jal
Summary	Transcriptional activator which binds to the enhancer of the T-cell receptor alpha and delta genes. Binds to the consensus sequence 5'-AGATAG-3'. Required for the T-helper 2 (Th2) differentiation process following immune and inflammatory responses.[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.