Mouse Col6a3 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Col6a3
Locus ID	12835
Kit Components	GA200823G1, Col6a3 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTGCCTTACAAGCATTTAGC GA200823G2, Col6a3 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAAGCTGATGTCACCTATGA GA200823G3, Col6a3 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TACAGTTTGGGTCTGTCCTA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001243008, NM_001243009, NM_009935
Synonyms	AI507288; Col6a-3

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.