Mouse Cacng1 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Cacng1
Locus ID	12299
Kit Components	GA200487G1, Cacng1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGAGTGGATACGGATAGTGG GA200487G2, Cacng1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGTGGCACTGAGGATTCCTT GA200487G3, Cacng1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CATTAATAGAAGTCTTCCTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_007582
Synonyms	MGC117703
Summary	Regulatory subunit of the voltage-gated calcium channel that gives rise to L-type calcium currents in skeletal muscle. Regulates channel inactivation kinetics.[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.