Human SCXA (SCX) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	SCX
Locus ID	642658
Kit Components	GA118670G1, SCXA gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGGGCTACGACCTGGATGGC GA118670G2, SCXA gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCCTGACTACTGGTGAGGGC GA118670G3, SCXA gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGTAGATGCGCCTGCCATCC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001080514
Synonyms	bHLHa48; SCXA; SCXB
Summary	Plays an early essential role in mesoderm formation, as well as a later role in formation of somite-derived chondrogenic lineages.[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.