Human UNC80 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	UNC80
Locus ID	285175
Kit Components	GA117196G1, UNC80 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAAAGCTCCTCCTACCCAGA GA117196G2, UNC80 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCACCTCCCACTGTGGACAG GA117196G3, UNC80 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTTTCAGCACCTCCCACTG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_032504, NM_182587
Synonyms	C2orf21; UNC-80
Summary	The protein encoded by this gene is a component of a voltage-independent 'leak' ion-channel complex, in which it performs essential functions, such as serving as a bridge between two other components (sodium leak channel non-selective and UNC79) and as a scaffold for Src kinases. Leak channels play an importnat role in establishment and maintenance of resting membrane potentials in neurons. Mutations in this gene are associated with congenital infantile encephalopathy, intellectual disability and growth issues. [provided by RefSeq, Aug 2016]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.