Human APOBEC3A activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	APOBEC3A
Locus ID	200315
Kit Components	GA116344G1, APOBEC3A gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCATGCCTCTGGGCAAGCTT GA116344G2, APOBEC3A gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTTTGCTCCCTGTGGGCCAC GA116344G3, APOBEC3A gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCTGAGCTGGAGAAGGGGTG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001270406, NM_145699
Synonyms	A3A; ARP3; bK150C2.1; PHRBN
Summary	This gene is a member of the cytidine deaminase gene family. It is one of seven related genes or pseudogenes found in a cluster, thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1. The protein encoded by this gene lacks the zinc binding activity of other family members. The protein plays a role in immunity, by restricting transmission of foreign DNA such as viruses. One mechanism of foreign DNA restriction is deamination of foreign double-stranded DNA cytidines to uridines, which leads to DNA degradation. However, other mechanisms are also thought to be involved, as anti-viral effect is not dependent on deaminase activity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.