Human Prominin 2 (PROM2) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	PROM2
Locus ID	150696
Kit Components	GA115763G1, Prominin 2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCCTGCCTTGGAGCATAGGA GA115763G2, Prominin 2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGGGTGGAGGCACAGGGTA GA115763G3, Prominin 2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATCTAGGTGGTGGGGAGCCC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001165977, NM_001165978, NM_144707, NM_001321070
Synonyms	PROML2
Summary	This gene encodes a member of the prominin family of pentaspan membrane glycoproteins. The encoded protein localizes to basal epithelial cells and may be involved in the organization of plasma membrane microdomains. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.