Human USP32 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	USP32
Locus ID	84669
Kit Components	GA113643G1, USP32 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTCACCCCCTTGCCCATCTG GA113643G2, USP32 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATCTCAGCAGGTGTGCCGGT GA113643G3, USP32 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGCGGTTTGGCTCCAGAACT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_032582
Synonyms	NY-REN-60; USP10

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.