Human SLC41A3 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	SLC41A3
Locus ID	54946
Kit Components	GA110393G1, SLC41A3 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGTATAAGTGGCACGTGCTA GA110393G2, SLC41A3 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACTGACCCTATGGAGACACC GA110393G3, SLC41A3 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCAGGCAAAGCCTCGAGCAC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001008485, NM_001008486, NM_001008487, NM_001164475, NM_017836
Synonyms	SLC41A1-L2

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.