Human ST6GALNAC6 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	ST6GALNAC6
Locus ID	30815
Kit Components	GA109385G1, ST6GALNAC6 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCCAGCTACTCAGTAGGCTG GA109385G2, ST6GALNAC6 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGAGTCTCACTCTGTCGCCC GA109385G3, ST6GALNAC6 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCTCGGCCTCCCAAAGTGCT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001286999, NM_001287000, NM_001287001, NM_001287002, NM_001287003, NM_013443, NR_104629
Synonyms	SIAT7-F; SIAT7F; ST6GALNACVI
Summary	ST6GALNAC6 belongs to a family of sialyltransferases that modify proteins and ceramides on the cell surface to alter cell-cell or cell-extracellular matrix interactions (Tsuchida et al., 2003 [PubMed 12668675]).[supplied by OMIM, Mar 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.