Human RAB18 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	RAB18
Locus ID	22931
Kit Components	GA107922G1, RAB18 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGTCCTCCCACTGACTCAAA GA107922G2, RAB18 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGCTACCTCAAGGCGGAAC GA107922G3, RAB18 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCCTTTCACACCGGGTGTTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001256410, NM_001256411, NM_001256412, NM_001256415, NM_021252, NR_046172, N56901
Synonyms	RAB18LI1; WARBM3
Summary	The protein encoded by this gene is a member of a family of Ras-related small GTPases that regulate membrane trafficking in organelles and transport vesicles. Knockdown studies is zebrafish suggest that this protein may have a role in eye and brain development. Mutations in this gene are associated with Warburg micro syndrome type 3. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.