Human GPRASP1 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	GPRASP1
Locus ID	9737
Kit Components	GA106545G1, GPRASP1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCACGCCTCTGCACCAAACT GA106545G2, GPRASP1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGATACGGCGCGAAAGTGC GA106545G3, GPRASP1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCACCTCTGGGTCGGAACTA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001099410, NM_001099411, NM_001184727, NM_014710
Synonyms	GASP; GASP-1; GASP1
Summary	This gene encodes a member of the GPRASP (G protein-coupled receptor associated sorting protein) family. The protein may modulate lysosomal sorting and functional down-regulation of a variety of G-protein coupled receptors. It targets receptors for degradation in lysosomes. The receptors interacting with this sorting protein include D2 dopamine receptor (DRD2), delta opioid receptor (OPRD1), beta-2 adrenergic receptor (ADRB2), D4 dopamine receptor (DRD4) and cannabinoid 1 receptor (CB1R). Multiple alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, May 2010]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.