Human CD83 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	CD83
Locus ID	9308
Kit Components	GA106201G1, CD83 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAATAGGAGACACTCTCCTT GA106201G2, CD83 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TACTGACTGATAACCTCCCG GA106201G3, CD83 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACATACAAGTCTGTAGTACT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001040280, NM_001251901, NM_004233
Synonyms	BL11; HB15
Summary	The protein encoded by this gene is a single-pass type I membrane protein and member of the immunoglobulin superfamily of receptors. The encoded protein may be involved in the regulation of antigen presentation. A soluble form of this protein can bind to dendritic cells and inhibit their maturation. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.