Human GPR65 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	GPR65
Locus ID	8477
Kit Components	GA105601G1, GPR65 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCGGGGAGATGTATACGAA GA105601G2, GPR65 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTGAGATGCTGCTTCCTCAT GA105601G3, GPR65 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACATATATTCCATTAAGTAA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_003608
Synonyms	hTDAG8; TDAG8
Summary	Receptor for the glycosphingolipid psychosine (PSY) and several related glycosphingolipids (PubMed:11309421). Plays a role in immune response by maintaining lysosome function and supporting phagocytosis-mediated intracellular bacteria clearance (PubMed:27287411). May have a role in activation-induced cell death or differentiation of T-cells (By similarity).[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.