Human ARID1A activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	ARID1A
Locus ID	8289
Kit Components	GA105467G1, ARID1A gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGGGGACTCGGAGGAGAGT GA105467G2, ARID1A gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CATTTTACCCAGCGCCGTCG GA105467G3, ARID1A gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGAGGGGAGAGAACAAGCCG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_006015, NM_018450, NM_139135
Synonyms	B120; BAF250; BAF250a; BM029; C1orf4; ELD; hELD; hOSA1; MRD14; OSA1; P270; SMARCF1
Summary	This gene encodes a member of the SWI/SNF family, whose members have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. It possesses at least two conserved domains that could be important for its function. First, it has a DNA-binding domain that can specifically bind an AT-rich DNA sequence known to be recognized by a SNF/SWI complex at the beta-globin locus. Second, the C-terminus of the protein can stimulate glucocorticoid receptor-dependent transcriptional activation. It is thought that the protein encoded by this gene confers specificity to the SNF/SWI complex and may recruit the complex to its targets through either protein-DNA or protein-protein interactions. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.