Human Cardiac Troponin T (TNNT2) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	TNNT2
Locus ID	7139
Kit Components	GA104931G1, Cardiac Troponin T gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGGACCACATGGGCTTATA GA104931G2, Cardiac Troponin T gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCACGCCATATAAGCCCATG GA104931G3, Cardiac Troponin T gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGTGCCAGGGACAAGGCTAC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_000364, NM_001001430, NM_001001431, NM_001001432, NM_001276345, NM_001276346, NM_001276347
Synonyms	CMD1D; CMH2; CMPD2; cTnT; LVNC6; RCM3; TnTC
Summary	The protein encoded by this gene is the tropomyosin-binding subunit of the troponin complex, which is located on the thin filament of striated muscles and regulates muscle contraction in response to alterations in intracellular calcium ion concentration. Mutations in this gene have been associated with familial hypertrophic cardiomyopathy as well as with dilated cardiomyopathy. Transcripts for this gene undergo alternative splicing that results in many tissue-specific isoforms, however, the full-length nature of some of these variants has not yet been determined. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.