Human SRD5A2 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	SRD5A2
Locus ID	6716
Kit Components	GA104615G1, SRD5A2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTTACTCTGTTGCCCAGGC GA104615G2, SRD5A2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCCCCACAAATGTTAGAGGC GA104615G3, SRD5A2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTTACCCTTCAGGCCAACCC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_000348
Synonyms	MGC138457
Summary	This gene encodes a microsomal protein expressed at high levels in androgen-sensitive tissues such as the prostate. The encoded protein is active at acidic pH and is sensitive to the 4-azasteroid inhibitor finasteride. Deficiencies in this gene can result in male pseudohermaphroditism, specifically pseudovaginal perineoscrotal hypospadias (PPSH). [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.