Human SRD5A1 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	SRD5A1
Locus ID	6715
Kit Components	GA104614G1, SRD5A1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCAGGCTTCTCCGGGGTAGC GA104614G2, SRD5A1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTGAGCCCGCGTGGGAAACC GA104614G3, SRD5A1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGTTACTGCGGCCCCGGCGT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001047, NM_001324322, NM_001324323, NR_136739
Synonyms	S5AR 1
Summary	Steroid 5-alpha-reductase (EC 1.3.99.5) catalyzes the conversion of testosterone into the more potent androgen, dihydrotestosterone (DHT). Also see SRD5A2 (MIM 607306).[supplied by OMIM, Mar 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.