Human Exodus 2 (CCL21) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	CCL21
Locus ID	6366
Kit Components	GA104328G1, Exodus 2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTCCAGGGGAGAGGCAGTG GA104328G2, Exodus 2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTGTCTCCTCACTACGCTCC GA104328G3, Exodus 2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTAACTCTGTCACCCAGGC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_002989
Synonyms	6Ckine; CKb9; ECL; SCYA21; SLC; TCA4
Summary	This antimicrobial gene is one of several CC cytokine genes clustered on the p-arm of chromosome 9. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. Similar to other chemokines the protein encoded by this gene inhibits hemopoiesis and stimulates chemotaxis. This protein is chemotactic in vitro for thymocytes and activated T cells, but not for B cells, macrophages, or neutrophils. The cytokine encoded by this gene may also play a role in mediating homing of lymphocytes to secondary lymphoid organs. It is a high affinity functional ligand for chemokine receptor 7 that is expressed on T and B lymphocytes and a known receptor for another member of the cytokine family (small inducible cytokine A19). [provided by RefSeq, Sep 2014]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.