Human Kallikrein 2 (KLK2) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	KLK2
Locus ID	3817
Kit Components	GA102587G1, Kallikrein 2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCAATCTGACCTCACACCGT GA102587G2, Kallikrein 2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CACATACTAGATCAGTCTGG GA102587G3, Kallikrein 2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTCAGCATCTAGGTGCCAAC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001002231, NM_001002232, NM_001256080, NM_005551, NR_045762, NR_045763
Synonyms	hGK-1; hK2; KLK2A2
Summary	This gene encodes a member of the grandular kallikrein protein family. Kallikreins are a subgroup of serine proteases that are clustered on chromosome 19. Members of this family are involved in a diverse array of biological functions. The protein encoded by this gene is a highly active trypsin-like serine protease that selectively cleaves at arginine residues. This protein is primarily expressed in prostatic tissue and is responsible for cleaving pro-prostate-specific antigen into its enzymatically active form. This gene is highly expressed in prostate tumor cells and may be a prognostic maker for prostate cancer risk. Alternate splicing results in both coding and non-coding transcript variants. [provided by RefSeq, Jan 2012]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.