Human HSF1 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	HSF1
Locus ID	3297
Kit Components	GA102251G1, HSF1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGGTGGGACCAACACGCGC GA102251G2, HSF1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACTGGAGCCTGAGCCCGAGC GA102251G3, HSF1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGCCCAAGACCGATTCACT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_005526
Synonyms	HSTF1
Summary	The product of this gene is a transcription factor that is rapidly induced after temperature stress and binds heat shock promoter elements (HSE). This protein plays a role in the regulation of lifespan. Expression of this gene is repressed by phosphorylation, which promotes binding by heat shock protein 90. [provided by RefSeq, Jul 2017]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.