Human Thrombin Receptor (F2R) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	F2R
Locus ID	2149
Kit Components	GA101496G1, Thrombin Receptor gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGACGTCTCCACATCCCAGG GA101496G2, Thrombin Receptor gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGCGAATCAACGGTGCCCAG GA101496G3, Thrombin Receptor gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGACTCTCACTGCACGCCGG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001311313, NM_001992, N35000
Synonyms	CF2R; HTR; PAR-1; PAR1; TR
Summary	Coagulation factor II receptor is a 7-transmembrane receptor involved in the regulation of thrombotic response. Proteolytic cleavage leads to the activation of the receptor. F2R is a G-protein coupled receptor family member. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.