Human Desmoplakin (DSP) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	DSP
Locus ID	1832
Kit Components	GA101283G1, Desmoplakin gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCGGAGCTGGGTGTTGGTGT GA101283G2, Desmoplakin gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGAAGAAACCGGCCAGGTG GA101283G3, Desmoplakin gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCTAGGCGCCCAGTGCCAGC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001008844, NM_001319034, NM_004415
Synonyms	DCWHKTA; DP; DPI; DPII
Summary	This gene encodes a protein that anchors intermediate filaments to desmosomal plaques and forms an obligate component of functional desmosomes. Mutations in this gene are the cause of several cardiomyopathies and keratodermas, including skin fragility-woolly hair syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.