Human GCSF Receptor (CSF3R) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	CSF3R
Locus ID	1441
Kit Components	GA101015G1, GCSF Receptor gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGACGTCTTGGTGAGGCAC GA101015G2, GCSF Receptor gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCACAGAATACGTAATGAAG GA101015G3, GCSF Receptor gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTACACAATTCCCTGGAACC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_000760, NM_156038, NM_156039, NM_172313
Synonyms	CD114; GCSFR
Summary	The protein encoded by this gene is the receptor for colony stimulating factor 3, a cytokine that controls the production, differentiation, and function of granulocytes. The encoded protein, which is a member of the family of cytokine receptors, may also function in some cell surface adhesion or recognition processes. Alternatively spliced transcript variants have been described. Mutations in this gene are a cause of Kostmann syndrome, also known as severe congenital neutropenia. [provided by RefSeq, Aug 2010]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.