Human CD70 activation kit by CRISPRa
CAT#: GA100691
CD70 CRISPRa kit - CRISPR gene activation of human CD70 molecule
CNY 12,255.00
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | CD70 |
Locus ID | 970 |
Kit Components | GA100691G1, CD70 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCAACTCTGAGGCTCACCCG GA100691G2, CD70 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCAGTCTGAAGATCCTAAAG GA100691G3, CD70 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGGACTTGAGCAATTGGCG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc. |
Reference Data | |
RefSeq | NM_001252, NM_001330332 |
Synonyms | CD27L; CD27LG; TNFSF7 |
Summary | The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for TNFRSF27/CD27. It is a surface antigen on activated, but not on resting, T and B lymphocytes. It induces proliferation of costimulated T cells, enhances the generation of cytolytic T cells, and contributes to T cell activation. This cytokine is also reported to play a role in regulating B-cell activation, cytotoxic function of natural killer cells, and immunoglobulin sythesis. [provided by RefSeq, Jul 2008] |
Documents
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN400410 | CD70 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8,680.00 |