Human CD70 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	CD70
Locus ID	970
Kit Components	GA100691G1, CD70 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCAACTCTGAGGCTCACCCG GA100691G2, CD70 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCAGTCTGAAGATCCTAAAG GA100691G3, CD70 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGGACTTGAGCAATTGGCG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001252, NM_001330332
Synonyms	CD27L; CD27LG; TNFSF7
Summary	The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for TNFRSF27/CD27. It is a surface antigen on activated, but not on resting, T and B lymphocytes. It induces proliferation of costimulated T cells, enhances the generation of cytolytic T cells, and contributes to T cell activation. This cytokine is also reported to play a role in regulating B-cell activation, cytotoxic function of natural killer cells, and immunoglobulin sythesis. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.