Human B7-2 (CD86) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	CD86
Locus ID	942
Kit Components	GA100664G1, B7-2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AACTCTCCACACTTTGGTTG GA100664G2, B7-2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAGTTTAAACTCATTGACGT GA100664G3, B7-2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACAGATTTTGACCACACTTG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001206924, NM_001206925, NM_006889, NM_175862, NM_176892
Synonyms	B7-2; B7.2; B70; CD28LG2; LAB72
Summary	This gene encodes a type I membrane protein that is a member of the immunoglobulin superfamily. This protein is expressed by antigen-presenting cells, and it is the ligand for two proteins at the cell surface of T cells, CD28 antigen and cytotoxic T-lymphocyte-associated protein 4. Binding of this protein with CD28 antigen is a costimulatory signal for activation of the T-cell. Binding of this protein with cytotoxic T-lymphocyte-associated protein 4 negatively regulates T-cell activation and diminishes the immune response. Alternative splicing results in several transcript variants encoding different isoforms.[provided by RefSeq, May 2011]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.