Human CACNA1C activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	CACNA1C
Locus ID	775
Kit Components	GA100540G1, CACNA1C gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTTTGATAGACCCTCTTGTG GA100540G2, CACNA1C gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGATCACCATGCCTTAGGG GA100540G3, CACNA1C gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCGTAAAGCCACTGGCTGAG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_000719, NM_001129827, NM_001129829, NM_001129830, NM_001129831, NM_001129832, NM_001129833, NM_001129834, NM_001129835, NM_001129836, NM_001129837, NM_001129838, NM_001129839, NM_001129840, NM_001129841, NM_001129842, NM_001129843, NM_001129844, NM_001129846, NM_001167623, NM_001167624, NM_001167625, NM_199460
Synonyms	CACH2; CACN2; CACNL1A1; CaV1.2; CCHL1A1; LQT8; TS
Summary	This gene encodes an alpha-1 subunit of a voltage-dependent calcium channel. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization. The alpha-1 subunit consists of 24 transmembrane segments and forms the pore through which ions pass into the cell. The calcium channel consists of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. There are multiple isoforms of each of these proteins, either encoded by different genes or the result of alternative splicing of transcripts. The protein encoded by this gene binds to and is inhibited by dihydropyridine. Alternative splicing results in many transcript variants encoding different proteins. Some of the predicted proteins may not produce functional ion channel subunits. [provided by RefSeq, Oct 2012]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.