Human ATF3 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	ATF3
Locus ID	467
Kit Components	GA100326G1, ATF3 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCACGGGAGAAAGCTGAGTG GA100326G2, ATF3 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTCGAAGGGAAGCCTCGGT GA100326G3, ATF3 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTGCTTTGTGGGGCGGAGGT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001030287, NM_001040619, NM_001206484, NM_001206485, NM_001206486, NM_001206488, NM_001674, NM_004024
Synonyms	FLJ41705
Summary	This gene encodes a member of the mammalian activation transcription factor/cAMP responsive element-binding (CREB) protein family of transcription factors. This gene is induced by a variety of signals, including many of those encountered by cancer cells, and is involved in the complex process of cellular stress response. Multiple transcript variants encoding different isoforms have been found for this gene. It is possible that alternative splicing of this gene may be physiologically important in the regulation of target genes. [provided by RefSeq, Apr 2011]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.