PPP2R5E (NM_001282181) Human Untagged Clone

CAT#: SC335814

PPP2R5E (untagged) - Human protein phosphatase 2, regulatory subunit B', epsilon isoform (PPP2R5E), transcript variant 4



  "NM_001282181" in other vectors (2)

CNY 3,710.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-PPP2R5E Antibody - N-terminal region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms B56E; B56epsilon
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335814 representing NM_001282181.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGACACGCTATCTGATCTTAAAATGAAAGAATACAAGCGCTCCACTCTTAATGAACTGGTGGACTAC
ATTACAATAAGCAGAGGCTGTTTGACAGAGCAGACTTACCCTGAAGTAGTTAGAATGGTATCTTGCAAT
ATATTCAGAACTCTCCCTCCTAGTGACAGCAATGAATTTGATCCAGAAGAAGATGAACCTACCCTTGAG
GCATCGTGGCCACACTTACAGCTTGTATATGAATTTTTCATACGATTTTTGGAAAGCCAAGAATTCCAA
CCCAGCATTGCCAAAAAATATATAGATCAGAAATTTGTATTACAGCTTCTGGAGCTATTTGACAGCGAA
GACCCTCGGGAACGGGACTACTTAAAAACAGTCTTACACAGAATTTATGGCAAGTTTCTTGGTCTTAGA
GCATTTATCCGAAAACAGATTAACAATATTTTTCTAAGGTTTGTTTATGAAACAGAACACTTCAATGGT
GTAGCTGAACTGCTGGAAATATTAGGAAGTATTATCAATGGCTTTGCTTTACCTCTTAAGGCAGAACAC
AAACAGTTTCTGGTGAAAGTATTGATCCCTTTACACACTGTCAGGAGCTTATCACTCTTCCATGCACAG
CTGGCATATTGTATAGTACAGTTTCTGGAGAAAGATCCTTCACTCACAGAACCAGTTATTAGGGGGTTA
ATGAAATTTTGGCCTAAAACATGTAGTCAAAAAGAGGTCATGTTCCTTGGGGAACTGGAAGAAATATTG
GATGTGATTGAACCTTCACAATTTGTTAAAATCCAAGAACCTTTGTTTAAACAAATCGCCAAGTGTGTA
TCTAGCCCCCATTTTCAGGTGGCAGAAAGAGCACTCTATTATTGGAATAATGAATACATCATGAGTTTG
ATAGAAGAAAACTCTAACGTCATCCTTCCCATCATGTTTTCCAGCCTTTATAGGATTTCAAAAGAACAT
TGGAATCCGGCTATTGTGGCGTTGGTGTACAATGTGTTGAAGGCATTTATGGAAATGAACAGCACCATG
TTTGACGAGCTGACAGCCACATACAAGTCAGATCGTCAGCGTGAGAAAAAGAAAGAAAAGGAGCGTGAA
GAATTGTGGAAAAAATTGGAGGATCTGGAGTTAAAGAGAGGTCTTAGACGTGATGGAATAATTCCAACT
TAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001282181
Insert Size 1176 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001282181.1
RefSeq Size 3490 bp
RefSeq ORF 1176 bp
Locus ID 5529
UniProt ID Q16537
Protein Families Druggable Genome, Phosphatase
Protein Pathways Oocyte meiosis, Wnt signaling pathway
MW 46.2 kDa
Gene Summary The protein encoded by this gene belongs to the phosphatase 2A regulatory subunit B family. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes an epsilon isoform of the regulatory subunit B56 subfamily. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (4) contains a distinct 5' UTR and lacks an in-frame portion of the 5' coding region, compared to variant 1. The resulting isoform (c) has a shorter N-terminus compared to isoform a. Variants 4 and 5 both encode the same isoform (c). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...