Dematin (DMTN) (NM_001302816) Human Untagged Clone

CAT#: SC335772

DMTN (untagged) - Human dematin actin binding protein (DMTN), transcript variant 7



  "NM_001302816" in other vectors (2)

CNY 3,710.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


DMTN rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DMT; EPB49
Vector pCMV6-Entry
Sequence Data
>SC335772 representing NM_001302816.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAACGGCTGCAGAAGCAACCACTTACCTCCCCCGGGAGCGTGAGCCCCTCCCGAGATTCCAGTGTG
CCTGGCTCTCCCTCCAGCATCGTGGCCAAGATGGACAATCAGGTGCTGGGCTACAAGGACCTGGCTGCC
ATCCCCAAGGACAAGGCCATCCTGGACATCGAGCGGCCCGACCTCATGATCTACGAGCCTCACTTCACT
TATTCCCTCCTGGAACACGTGGAGCTGCCTCGCAGCCGCGAGCGCTCGCTGTCACCCAAATCCACATCC
CCCCCACCATCCCCAGAGGTGTGGGCGGACAGCCGGTCGCCTGGAATCATCTCTCAGGCCTCGGCCCCC
AGAACCACTGGAACCCCCCGGACCAGCCTGCCCCATTTCCACCACCCTGAGACCTCCCGCCCAGATTCC
AACATCTACAAGAAGCCTCCCATCTATAAGCAGAGAGAGTCCGTGGGAGGCAGCCCTCAGACCAAGCAC
CTCATCGAGGATCTCATCATCGAGTCATCCAAGTTTCCTGCAGCCCAGCCCCCAGACCCCAACCAGCCA
GCCAAAATCGAAACCGACTACTGGCCATGCCCCCCGTCTCTGGCTGTTGTGGAGACAGAATGGAGGAAG
CGGAAGGCGTCTCGGAGGGGAGCAGAGGAAGAGGAGGAGGAGGAAGATGACGACTCTGGAGAGGAGATG
AAGGCTCTCAGGGAGCGTCAGAGAGAGGAACTCAGTAAGGTTACTTCCAACTTGGGAAAGATGATCTTG
AAAGAAGAGATGGAAAAGTCATTGCCGATCCGAAGGAAAACCCGCTCTCTGCCTGACCGGACACCCTTC
CATACCTCCTTGCACCAGGGAACGTCTAAATCTTCCTCTCTCCCCGCCTATGGCAGGACCACCCTGAGC
CGGCTACAGTCCACAGAGTTCAGCCCATCAGGGAGTGAGACTGGAAGCCCAGGCCTGCAGATCTATCCC
TATGAAATGCTAGTGGTGACCAACAAGGGGCGAACCAAGCTGCCACCGGGGGTGGATCGGATGCGGCTT
GAGAGGCATCTGTCTGCCGAGGACTTCTCAAGGGTATTTGCCATGTCCCCTGAAGAGTTTGGCAAGCTG
GCTCTGTGGAAGCGGAATGAGCTCAAGAAGAAGGCCTCTCTCTTCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001302816
Insert Size 1152 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001302816.1
RefSeq Size 2754 bp
RefSeq ORF 1152 bp
Locus ID 2039
UniProt ID Q08495
MW 43.1 kDa
Gene Summary The protein encoded by this gene is an actin binding and bundling protein that plays a structural role in erythrocytes, by stabilizing and attaching the spectrin/actin cytoskeleton to the erythrocyte membrane in a phosphorylation-dependent manner. This protein contains a core domain in the N-terminus, and a headpiece domain in the C-terminus that binds F-actin. When purified from erythrocytes, this protein exists as a trimer composed of two 48 kDa polypeptides and a 52 kDa polypeptide. The different subunits arise from alternative splicing in the 3' coding region, where the headpiece domain is located. Disruption of this gene has been correlated with the autosomal dominant Marie Unna hereditary hypotrichosis disease, while loss of heterozygosity of this gene is thought to play a role in prostate cancer progression. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014]
Transcript Variant: This variant (7) lacks an alternate in-frame exon in the 3' coding region, compared to variant 1. Variants 4, 5 and 7 encode the same isoform (2, also known as the 48 kDa subunit, PMID:7615546), which is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...