FBXO31 (NM_001282683) Human Untagged Clone

CAT#: SC335654

FBXO31 (untagged) - Human F-box protein 31 (FBXO31), transcript variant 2



  "NM_001282683" in other vectors (2)

CNY 3,520.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
FBXO31 mouse monoclonal antibody, clone OTI1H1 (formerly 1H1)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FBX14; Fbx31; FBXO14; MRT45; pp2386
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335654 representing NM_001282683.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTACCTGCCTCCCCATGACCCCCACGTCGATGACCCTATGAGATTCAAGCCTCTGTTCAGGATCCAC
CTGATGGAGAGGAAGGCTGCCACAGTGGAGTGCATGTACGGCCACAAAGGGCCCCACCACGGCCACATC
CAGATTGTGAAGAAGGATGAGTTCTCCACCAAGTGCAACCAGACGGACCACCACAGGATGTCCGGCGGG
AGGCAGGAGGAGTTTCGGACGTGGCTGAGGGAGGAATGGGGGCGCACGCTGGAGGACATCTTCCACGAG
CACATGCAGGAGCTCATCCTGATGAAGTTCATCTACACCAGTCAGTACGACAACTGCCTGACCTACCGC
CGCATCTACCTGCCGCCCAGCCGCCCCGACGACCTCATCAAGCCTGGCCTCTTCAAAGGTACCTATGGC
AGCCACGGCCTGGAGATTGTGATGCTCAGCTTCCACGGCCGGCGTGCCAGGGGCACCAAGATCACGGGC
GACCCCAACATCCCCGCTGGGCAGCAGACAGTGGAGATCGACCTGAGGCATCGGATCCAGCTGCCCGAC
CTCGAGAACCAGCGCAACTTCAATGAGCTCTCCCGCATCGTCCTGGAGGTGCGCGAGAGGGTGCGCCAG
GAGCAGCAGGAAGGCGGGCACGAGGCGGGCGAGGGTCGTGGCCGGCAGGGCCCCCGGGAGTCCCAGCCA
AGCCCTGCCCAGCCCAGGGCAGAGGCGCCCAGCAAGGGCCCAGATGGGACACCTGGTGAGGATGGTGGC
GAGCCTGGGGATGCCGTAGCTGCGGCCGAGCAGCCTGCCCAGTGTGGGCAGGGGCAGCCGTTCGTGCTG
CCCGTGGGCGTGAGCTCCAGGAATGAGGACTACCCCCGAACCTGCAGGATGTGTTTTTATGGCACAGGC
CTCATCGCGGGCCACGGCTTCACCAGCCCTGAACGCACCCCCGGGGTCTTCATCCTCTTCGATGAGGAC
CGCTTCGGGTTCGTCTGGCTGGAGCTGAAATCCTTCAGCCTGTACAGCCGGGTCCAGGCCACCTTCCGG
AACGCAGATGCGCCGTCCCCACAGGCCTTCGATGAGATGCTCAAGAACATTCAGTCCCTCACCTCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001282683
Insert Size 1104 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001282683.1
RefSeq Size 5738 bp
RefSeq ORF 1104 bp
Locus ID 79791
UniProt ID Q5XUX0
Protein Families Druggable Genome
MW 41.7 kDa
Gene Summary This gene is a member of the F-box family. Members are classified into three classes according to the substrate interaction domain, FBW for WD40 repeats, FBL for leucing-rich repeats, and FBXO for other domains. This protein, classified into the last category because of the lack of a recognizable substrate binding domain, has been proposed to be a component of the SCF ubiquitination complex. It is thought to bind and recruit substrate for ubiquitination and degradation. This protein may have a role in regulating the cell cycle as well as dendrite growth and neuronal migration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Transcript Variant: This variant (2) represents use of an alternate promoter and thus differs in the 5' UTR and 5' coding region compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (2) with a shorter N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...