PTP1B (PTPN1) (NM_001278618) Human Untagged Clone

CAT#: SC335618

PTPN1 (untagged) - Human protein tyrosine phosphatase, non-receptor type 1 (PTPN1), transcript variant 2



  "NM_001278618" in other vectors (2)

CNY 3,520.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
PTPN1 (PTP1B) mouse monoclonal antibody, clone OTI1D10 (formerly 1D10)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PTP1B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335618 representing NM_001278618.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAAGAAGCCCAAAGGAGTTACATTCTTACCCAGGGCCCTTTGCCTAACACATGCGGTCACTTTTGG
GAGATGGTGTGGGAGCAGAAAAGCAGGGGTGTCGTCATGCTCAACAGAGTGATGGAGAAAGGTTCGTTA
AAATGCGCACAATACTGGCCACAAAAAGAAGAAAAAGAGATGATCTTTGAAGACACAAATTTGAAATTA
ACATTGATCTCTGAAGATATCAAGTCATATTATACAGTGCGACAGCTAGAATTGGAAAACCTTACAACC
CAAGAAACTCGAGAGATCTTACATTTCCACTATACCACATGGCCTGACTTTGGAGTCCCTGAATCACCA
GCCTCATTCTTGAACTTTCTTTTCAAAGTCCGAGAGTCAGGGTCACTCAGCCCGGAGCACGGGCCCGTT
GTGGTGCACTGCAGTGCAGGCATCGGCAGGTCTGGAACCTTCTGTCTGGCTGATACCTGCCTCTTGCTG
ATGGACAAGAGGAAAGACCCTTCTTCCGTTGATATCAAGAAAGTGCTGTTAGAAATGAGGAAGTTTCGG
ATGGGGCTGATCCAGACAGCCGACCAGCTGCGCTTCTCCTACCTGGCTGTGATCGAAGGTGCCAAATTC
ATCATGGGGGACTCTTCCGTGCAGGATCAGTGGAAGGAGCTTTCCCACGAGGACCTGGAGCCCCCACCC
GAGCATATCCCCCCACCTCCCCGGCCACCCAAACGAATCCTGGAGCCACACAATGGGAAATGCAGGGAG
TTCTTCCCAAATCACCAGTGGGTGAAGGAAGAGACCCAGGAGGATAAAGACTGCCCCATCAAGGAAGAA
AAAGGAAGCCCCTTAAATGCCGCACCCTACGGCATCGAAAGCATGAGTCAAGACACTGAAGTTAGAAGT
CGGGTCGTGGGGGGAAGTCTTCGAGGTGCCCAGGCTGCCTCCCCAGCCAAAGGGGAGCCGTCACTGCCC
GAGAAGGACGAGGACCATGCACTGAGTTACTGGAAGCCCTTCCTGGTCAACATGTGCGTGGCTACGGTC
CTCACGGCCGGCGCTTACCTCTGCTACAGGTTCCTGTTCAACAGCAACACATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001278618
Insert Size 1089 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001278618.1
RefSeq Size 3482 bp
RefSeq ORF 1089 bp
Locus ID 5770
UniProt ID P18031
Protein Families Druggable Genome, Phosphatase, Transmembrane
Protein Pathways Adherens junction, Insulin signaling pathway
MW 41.3 kDa
Gene Summary The protein encoded by this gene is the founding member of the protein tyrosine phosphatase (PTP) family, which was isolated and identified based on its enzymatic activity and amino acid sequence. PTPs catalyze the hydrolysis of the phosphate monoesters specifically on tyrosine residues. Members of the PTP family share a highly conserved catalytic motif, which is essential for the catalytic activity. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP has been shown to act as a negative regulator of insulin signaling by dephosphorylating the phosphotryosine residues of insulin receptor kinase. This PTP was also reported to dephosphorylate epidermal growth factor receptor kinase, as well as JAK2 and TYK2 kinases, which implicated the role of this PTP in cell growth control, and cell response to interferon stimulation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (2) lacks an alternate exon in the 5' coding region and uses a downstream start codon compared to variant 1. It encodes isoform 2, which has a shorter N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...