TRIB3 (NM_001301193) Human Untagged Clone

CAT#: SC335594

TRIB3 (untagged) - Human tribbles pseudokinase 3 (TRIB3), transcript variant 4



  "NM_001301193" in other vectors (2)

CNY 3,420.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TRIB3 mouse monoclonal antibody, clone OTI3C6 (formerly 3C6)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C20orf97; NIPK; SINK; SKIP3; TRB3
Vector pCMV6-Entry
Sequence Data
>SC335594 representing NM_001301193.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCGAGCCACCCCTCTGGCTGCTCCTGCGGGTTCCCTGTCCAGGAAGAAGCGGTTGGAGTTGGATGAC
AACTTAGATACCGAGCGTCCCGTCCAGAAACGAGCTCGAAGTGGGCCCCAGCCCAGACTGCCCCCCTGC
CTGTTGCCCCTGAGCCCACCTACTGCTCCAGATCGTGCAACTGCTGTGGCCACTGCCTCCCGTCTTGGG
CCCTATGTCCTCCTGGAGCCCGAGGAGGGCGGGCGGGCCTACCAGGCCCTGCACTGCCCTACAGGCACT
GAGTATACCTGCAAGGTGTACCCCGTCCAGGAAGCCCTGGCCGTGCTGGAGCCCTATGCGCGGCTGCCC
CCGCACAAGCATGTGGCTCGGCCCACTGAGGTCCTGGCTGGTACCCAGCTCCTCTACGCCTTTTTCACT
CGGACCCATGGGGACATGCACAGCCTGGTGCGAAGCCGCCACCGTATCCCTGAGCCTGAGGCTGCCGTG
CTCTTCCGCCAGATGGCCACCGCCCTGGCGCACTGTCACCAGCACGGTCTGGTCCTGCGTGATCTCAAG
CTGTGTCGCTTTGTCTTCGCTGACCGTGAGAGGAAGAAGCTGGTGCTGGAGAACCTGGAGGACTCCTGC
GTGCTGACTGGGCCAGATGATTCCCTGTGGGACAAGCACGCGTGCCCAGCCTACGTGGGACCTGAGATA
CTCAGCTCACGGGCCTCATACTCGGGCAAGGCAGCCGATGTCTGGAGCCTGGGCGTGGCGCTCTTCACC
ATGCTGGCCGGCCACTACCCCTTCCAGGACTCGGAGCCTGTCCTGCTCTTCGGCAAGATCCGCCGCGGG
GCCTACGCCTTGCCTGCAGGCCTCTCGGCCCCTGCCCGCTGTCTGGTTCGCTGCCTCCTTCGTCGGGAG
CCAGCTGAACGGCTCACAGCCACAGGCATCCTCCTGCACCCCTGGCTGCGACAGGACCCGATGCCCTTA
GCCCCAACCCGATCCCATCTCTGGGAGGCTGCCCAGGTGGTCCCTGATGGACTGGGGCTGGACGAAGCC
AGGGAAGAGGAGGGAGACAGAGAAGTGGTTCTGTATGGCTAG

Restriction Sites SgfI-RsrII     
ACCN NM_001301193
Insert Size 1077 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001301193.1
RefSeq Size 2160 bp
RefSeq ORF 1077 bp
Locus ID 57761
UniProt ID Q96RU7
Protein Families Druggable Genome, Protein Kinase, Transcription Factors
MW 39.6 kDa
Gene Summary The protein encoded by this gene is a putative protein kinase that is induced by the transcription factor NF-kappaB. The encoded protein is a negative regulator of NF-kappaB and can also sensitize cells to TNF- and TRAIL-induced apoptosis. In addition, this protein can negatively regulate the cell survival serine-threonine kinase AKT1. Differential promoter usage and alternate splicing result in multiple transcript variants. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (4, also known as 1B3) has an alternate 5' UTR exon, compared to variant 1. Variants 1, 2, 3, 4 and 5 encode the same isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...