SGK196 (POMK) (NM_001277971) Human Untagged Clone

CAT#: SC335533

POMK (untagged) - Human protein-O-mannose kinase (POMK), transcript variant 2



  "NM_001277971" in other vectors (2)

CNY 3,420.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


SGK196 mouse monoclonal antibody, clone OTI1B1 (formerly 1B1)
    • 100 ul

CNY 1,999.00
CNY 2,700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MDDGA12; MDDGC12; SGK196
Vector pCMV6-Entry
Sequence Data
>SC335533 representing NM_001277971.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAAAAGCAGCCCCAGAACAGCAGGAGAGGCCTCGCCCCCCGAGAGGTGCCGCCAGCTGTTGGGCTG
CTGCTGATCATGGCCCTGATGAATACTCTGCTCTACCTCTGCCTCGACCACTTCTTCATCGCTCCTCGA
CAATCCACTGTGGACCCCACACACTGTCCCTATGGTCACTTCAGGATAGGACAGATGAAAAACTGCTCA
CCTTGGCTGTCCTGCGAGGAGCTGAGAACAGAAGTGAGACAGCTGAAGCGTGTTGGGGAAGGAGCTGTA
AAGAGAGTCTTTCTGTCTGAGTGGAAGGAGCACAAAGTTGCACTCTCACAGCTCACCAGCCTGGAGATG
AAAGATGATTTCCTCCATGGACTGCAGATGCTGAAATCTCTCCAAGGCACACATGTTGTCACGCTGCTT
GGCTATTGTGAGGATGACAACACTATGCTTACTGAATATCACCCTCTAGGTTCCTTGAGTAACCTGGAA
GAAACACTAAACCTTTCAAAGTACCAAAATGTGAACACGTGGCAGCACAGGCTGGAGCTGGCCATGGAC
TATGTCAGCATCATTAATTACCTGCACCACAGCCCTGTGGGCACACGGGTCATGTGCGACTCCAACGAC
CTGCCGAAGACACTGTCCCAGTATCTGCTAACAAGCAACTTCAGCATTTTGGCAAATGACTTGGACGCC
TTACCCCTGGTGAACCACAGCTCCGGGATGCTGGTGAAGTGCGGCCACAGGGAGCTGCATGGGGATTTC
GTGGCTCCAGAGCAACTGTGGCCCTATGGAGAGGACGTGCCTTTCCACGATGATCTCATGCCCTCATAT
GATGAGAAGATTGACATTTGGAAGATCCCAGACATCTCCAGTTTCCTTCTGGGGCACATTGAAGGGAGT
GATATGGTCCGATTCCATTTGTTTGATATTCACAAAGCATGCAAGAGCCAGACTCCCTCAGAAAGACCC
ACTGCCCAGGACGTTCTGGAGACCTACCAGAAGGTCTTGGATACACTTAGAGATGCCATGATGTCTCAG
GCAAGAGAGATGCTGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001277971
Insert Size 1053 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001277971.1
RefSeq Size 1527 bp
RefSeq ORF 1053 bp
Locus ID 84197
UniProt ID Q9H5K3
Protein Families Druggable Genome, Protein Kinase, Transmembrane
MW 40 kDa
Gene Summary This gene encodes a protein that may be involved in the presentation of the laminin-binding O-linked carbohydrate chain of alpha-dystroglycan (a-DG), which forms transmembrane linkages between the extracellular matrix and the exoskeleton. Some pathogens use this O-linked carbohydrate unit for host entry. Loss of function compound heterozygous mutations in this gene were found in a human patient affected by the Walker-Warburg syndrome (WWS) phenotype. Mice lacking this gene contain misplaced neurons (heterotopia) in some regions of the brain, possibly from defects in neuronal migration. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
Transcript Variant: This variant (2) lacks an alternate exon in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...