GBGT1 (NM_001282632) Human Untagged Clone

CAT#: SC335385

GBGT1 (untagged) - Human globoside alpha-1,3-N-acetylgalactosaminyltransferase 1 (GBGT1), transcript variant 3



  "NM_001282632" in other vectors (2)

CNY 3,230.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


GBGT1 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms A3GALNT; FS; UNQ2513
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335385 representing NM_001282632.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCATCGCCGGAGACTGGCCCTGGGTCTGGGGTTCTGCCTGTTGGCGGGCACAAGCCTCAGTGTCCTG
TGGGTGTATCTTGAGAACTGGCTGCCAGTCTCCTATGTCCCCTATTATCTCCCCTGCCCAGAGATCTTG
TCACAGTACCCTCAGCCCAAGCTGCTGGAGCACAGGCCCACACAGCTGCTGACACTCACACCCTGGTTG
GCGCCCATCGTCTCCGAGGGAACCTTCAACCCAGAGCTTCTGCAGCACATCTACCAGCCACTGAACCTG
ACCATTGGGGTCACGGTGTTTGCCGTGGGGAAGTACACTCATTTCATCCAGTCCTTCCTGGAGTCAGCC
GAGGAGTTCTTCATGCGTGGGTACCGGGTGCACTACTACATCTTCACTGACAACCCTGCAGCCGTTCCC
GGGGTCCCGCTGGGTCCCCACCGGCTTCTCAGCTCCATCCCCATCCAGGGTCACTCCCACTGGGAGGAG
ACATCCATGCGCCGGATGGAGACCATCAGCCAGCACATTGCTAAGAGGGCTCACCGGGAGGTGGACTAC
CTCTTCTGCCTTGATGTGGACATGGTGTTTCGGAACCCGTGGGGCCCTGAGACCTTGGGAGACCTGGTG
GCTGCCATTCACCCAAGCTACTACGCCGTTCCCCGCCAGCAGTTCCCCTATGAGCGCAGGCGTGTTTCC
ACTGCCTTTGTGGCAGACAGCGAAGGGGACTTCTATTATGGTGGGGCAGTCTTCGGGGGGCAGGTGGCC
AGGGTATATGAGTTTACTAGGGGCTGCCACATGGCCATCCTGGCGGACAAGGCCAATGGCATCATGGCT
GCCTGGCGGGAGGAAAGCCACCTGAACCGTCACTTCATCTCAAACAAGCCGTCCAAGGTGCTGTCCCCC
GAGTACCTCTGGGACGACAGGAAGCCCCAGCCACCCAGCCTGAAGCTGATCCGCTTTTCTACACTGGAC
AAGGATATCAGCTGCCTGAGGAGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001282632
Insert Size 993 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001282632.1
RefSeq Size 1934 bp
RefSeq ORF 993 bp
Locus ID 26301
UniProt ID Q8N5D6
Protein Families Transmembrane
Protein Pathways Glycosphingolipid biosynthesis - globo series, Metabolic pathways
MW 37.9 kDa
Gene Summary This gene encodes a glycosyltransferase that plays a role in the synthesis of Forssman glycolipid (FG), a member of the globoseries glycolipid family. Glycolipids such as FG form attachment sites for the binding of pathogens to cells; expression of this protein may determine host tropism to microorganisms. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Transcript Variant: This variant (3) lacks an in-frame exon in the 5' coding region compared to variant 1. The encoded isoform (3) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...