P2Y6 (P2RY6) (NM_001277204) Human Untagged Clone

CAT#: SC335363

P2RY6 (untagged) - Human pyrimidinergic receptor P2Y, G-protein coupled, 6 (P2RY6), transcript variant 5



  "NM_001277204" in other vectors (2)

CNY 3,230.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
P2RY6 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms P2Y6
Vector pCMV6-Entry
Sequence Data
>SC335363 representing NM_001277204.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAATGGGACAATGGCACAGGCCAGGCTCTGGGCTTGCCACCCACCACCTGTGTCTACCGCGAGAAC
TTCAAGCAACTGCTGCTGCCACCTGTGTATTCGGCGGTGCTGGCGGCTGGCCTGCCGCTGAACATCTGT
GTCATTACCCAGATCTGCACGTCCCGCCGGGCCCTGACCCGCACGGCCGTGTACACCCTAAACCTTGCT
CTGGCTGACCTGCTATATGCCTGCTCCCTGCCCCTGCTCATCTACAACTATGCCCAAGGTGATCACTGG
CCCTTTGGCGACTTCGCCTGCCGCCTGGTCCGCTTCCTCTTCTATGCCAACCTGCACGGCAGCATCCTC
TTCCTCACCTGCATCAGCTTCCAGCGCTACCTGGGCATCTGCCACCCGCTGGCCCCCTGGCACAAACGT
GGGGGCCGCCGGGCTGCCTGGCTAGTGTGTGTAGCCGTGTGGCTGGCCGTGACAACCCAGTGCCTGCCC
ACAGCCATCTTCGCTGCCACAGGCATCCAGCGTAACCGCACTGTCTGCTATGACCTCAGCCCGCCTGCC
CTGGCCACCCACTATATGCCCTATGGCATGGCTCTCACTGTCATCGGCTTCCTGCTGCCCTTTGCTGCC
CTGCTGGCCTGCTACTGTCTCCTGGCCTGCCGCCTGTGCCGCCAGGATGGCCCGGCAGAGCCTGTGGCC
CAGGAGCGGCGTGGCAAGGCGGCCCGCATGGCCGTGGTGGTGGCTGCTGCCTTTGCCATCAGCTTCCTG
CCTTTTCACATCACCAAGACAGCCTACCTGGCAGTGCGCTCGACGCCGGGCGTCCCCTGCACTGTATTG
GAGGCCTTTGCAGCGGCCTACAAAGGCACGCGGCCGTTTGCCAGTGCCAACAGCGTGCTGGACCCCATC
CTCTTCTACTTCACCCAGAAGAAGTTCCGCCGGCGACCACATGAGCTCCTACAGAAACTCACAGCCAAA
TGGCAGAGGCAGGGTCGCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001277204
Insert Size 987 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001277204.1
RefSeq Size 2552 bp
RefSeq ORF 987 bp
Locus ID 5031
UniProt ID Q15077
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
MW 36.4 kDa
Gene Summary The product of this gene belongs to the family of P2 receptors, which is activated by extracellular nucleotides and subdivided into P2X ligand-gated ion channels and P2Y G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor, which is a G-protein coupled receptor, is responsive to UDP, partially responsive to UTP and ADP, and not responsive to ATP. It is proposed that this receptor mediates inflammatory responses. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Mar 2013]
Transcript Variant: This variant (5) differs in the 5' UTR compared to variant 1. Variants 1,2,3,5,6,7, and 8 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...