HIP55 (DBNL) (NM_001284313) Human Untagged Clone

CAT#: SC335357

DBNL (untagged) - Human drebrin-like (DBNL), transcript variant 4



  "NM_001284313" in other vectors (2)

CNY 3,230.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
DBNL mouse monoclonal antibody, clone OTI6C9 (formerly 6C9)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ABP1; HIP-55; HIP55; SH3P7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335357 representing NM_001284313.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCAGCTTCCTGAAGGGGGCCCATGTGACCATCAACGCACGGGCCGAGGAGGATGTGGAGCCTGAG
TGCATCATGGAGAAGGTGGCCAAGGCTTCAGGTGCCAACTACAGCTTTCACAAGGAGAGTGGCCGCTTC
CAGGACGTGGGACCCCAGGCCCCAGTGGGCTCTGTGTACCAGAAGACCAATGCCGTGTCTGAGATTAAA
AGGGTTGGTAAAGACAGCTTCTGGGCCAAAGCAGAGAAGGAGGAGGAGAACCGTCGGCTGGAGGAAAAG
CGGCGGGCCGAGGAGGCACAGCGGCAGCTGGAGCAGGAGCGCCGGGAGCGTGAGCTGCGTGAGGCTGCA
CGCCGGGAGCAGCGCTATCAGGAGCAGGGTGGCGAGGCCAGCCCCCAGAGGACGTGGGAGCAGCAGCAA
GAAGTGGTTTCAAGGAACCGAAATGAGCAGGAGTCTGCCGTGCACCCGAGGGAGATTTTCAAGCAGAAG
GAGAGGGCCATGTCCACCACCTCCATCTCCAGTCCTCAGCCTGGCAAGCTGAGGAGCCCCTTCCTGCAG
AAGCAGCTCACCCAACCAGAGACCCACTTTGGCAGAGAGCCAGCTGCTGCCATCTCAAGGCCCAGGGCA
GATCTCCCTGCTGAGGAGCCGGCGCCCAGCACTCCTCCATGTCTGGTGCAGGCAGAAGAGGAGGCTGTG
TATGAGGAACCTCCAGAGCAGGAGACCTTCTACGAGCAGCCCCCACTGGTGCAGCAGCAAGGTGCTGGC
TCTGAGCACATTGACCACCACATTCAGGGCCAGGGGCTCAGTGGGCAAGGGCTCTGTGCCCGTGCCCTG
TACGACTACCAGGCAGCCGACGACACAGAGATCTCCTTTGACCCCGAGAACCTCATCACGGGCATCGAG
GTGATCGACGAAGGCTGGTGGCGTGGCTATGGGCCGGATGGCCATTTTGGCATGTTCCCTGCCAACTAC
GTGGAGCTCATTGAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001284313
Insert Size 984 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001284313.1
RefSeq Size 2041 bp
RefSeq ORF 984 bp
Locus ID 28988
UniProt ID Q9UJU6
MW 37.1 kDa
Gene Summary Adapter protein that binds F-actin and DNM1, and thereby plays a role in receptor-mediated endocytosis. Plays a role in the reorganization of the actin cytoskeleton, formation of cell projections, such as neurites, in neuron morphogenesis and synapse formation via its interaction with WASL and COBL. Does not bind G-actin and promote actin polymerization by itself. Required for the formation of organized podosome rosettes (By similarity). May act as a common effector of antigen receptor-signaling pathways in leukocytes. Acts as a key component of the immunological synapse that regulates T-cell activation by bridging TCRs and the actin cytoskeleton to gene activation and endocytic processes.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) lacks two exons, uses an alternate in-frame splice site and initiates translation at a downstream start codon compared to variant 1. The encoded isoform (d) has a shorter N-terminus compared to isoform c. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...