HEXIM2 (NM_001303436) Human Untagged Clone

CAT#: SC335247

HEXIM2 (untagged) - Human hexamethylene bis-acetamide inducible 2 (HEXIM2), transcript variant 10



  "NM_001303436" in other vectors (2)

CNY 3,040.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


HEXIM2 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms L3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335247 representing NM_001303436.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGCTTTGGTGTAAGCGAGGTGTCACTAGTTCCAGGCGTCTGCTGAAAGATTTGGAACAGAAGATG
ATGGCCACTCCGAACCAGACCGCCTGTAATGCAGAGTCACCAGTGGCCCTGGAGGAGGCCAAGACCTCT
GGTGCCCCGGGGAGCCCCCAAACACCCCCTGAGCGTCATGACTCTGGTGGTTCCCTGCCCCTGACACCG
CGGATGGAGAGCCACTCAGAGGATGAAGATCTTGCTGGGGCTGTCGGTGGCCTGGGCTGGAACAGTAGG
AGTCCCCGGACCCAGAGCCCAGGGGGCTGCTCAGCGGAGGCTGTGCTGGCCCGGAAGAAACACCGTCGG
CGGCCATCGAAGCGCAAAAGGCACTGGCGACCCTACCTGGAGCTGAGCTGGGCTGAGAAACAACAGCGG
GATGAGAGGCAGAGCCAGAGGGCCTCCCGGGTCCGCGAAGAGATGTTCGCCAAAGGCCAGCCCGTGGCC
CCCTACAACACCACCCAGTTCCTGATGAATGACAGGGACCCGGAGGAGCCCAACTTGGATGTGCCCCAT
GGGATCTCCCACCCAGGTTCCAGTGGGGAGAGTGAGGCCGGGGACAGTGATGGGCGGGGCCGAGCGCAC
GGTGAGTTCCAGCGGAAGGACTTCTCTGAGACTTACGAACGCTTCCACACCGAGAGCCTGCAGGGCCGC
AGCAAGCAGGAGCTGGTGCGAGACTACCTGGAGCTGGAGAAGCGGCTGTCGCAGGCGGAGGAGGAGACT
AGGAGGCTGCAGCAGCTGCAGGCGTGCACCGGCCAGCAGTCCTGCCGCCAGGTGGAGGAGCTGGCTGCC
GAGGTCCAGAGGCTCCGGACCGAAAACCAGCGGCTTCGTCAGGAGAACCAGATGTGGAACCGAGAGGGC
TGCCGCTGTGATGAGGAGCCGGGTACCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001303436
Insert Size 927 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001303436.1
RefSeq Size 1923 bp
RefSeq ORF 927 bp
Locus ID 124790
UniProt ID Q96MH2
Protein Families Transcription Factors
MW 35 kDa
Gene Summary This gene encodes a member of the HEXIM family of proteins. This protein is a component of the 7SK small nuclear ribonucleoprotein. This protein has been found to negatively regulate the kinase activity of the cyclin-dependent kinase P-TEFb, which phosphorylates multiple target proteins to promote transcriptional elongation. This gene is located approximately 7 kb downstream from related family member HEXIM1 on chromosome 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Transcript Variant: This variant (10) uses an alternate splice site in the 5' terminal exon and initiates translation at an upstream start codon, compared to variant 1. This results in a protein (isoform 2) with a longer N-terminus compared to variant 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...