TID1 (DNAJA3) (NM_001286516) Human Untagged Clone

CAT#: SC335200

DNAJA3 (untagged) - Human DnaJ (Hsp40) homolog, subfamily A, member 3 (DNAJA3), transcript variant 3



  "NM_001286516" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-DNAJA3 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HCA57; hTID-1; TID1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335200 representing NM_001286516.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTGAGCCGCAAGCTGAGCGTCCCCGCCTTTGCGTCTTCCCTGACCTCTTGCGGCCCCCGAGCGCT
GCTGACATTGAGACCTGGTGTCAGCCTTACAGGAAGATCTTTGGCGAGTTCTCATCCTCTTCATTTGGA
GATTTCCAGACCGTGTTTGATCAGCCTCAGGAATACTTCATGGAGTTGACATTCAATCAAGCTGCAAAG
GGGGTCAACAAGGAGTTCACCGTGAACATCATGGACACGTGTGAGCGCTGCAACGGCAAGGGGAACGAG
CCCGGCACCAAGGTGCAGCATTGCCACTACTGTGGCGGCTCCGGCATGGAAACCATCAACACAGGCCCT
TTTGTGATGCGTTCCACGTGTAGGAGATGTGGTGGCCGCGGCTCCATCATCATATCGCCCTGTGTGGTC
TGCAGGGGAGCAGGACAAGCCAAGCAGAAAAAGCGAGTGATGATCCCTGTGCCTGCAGGAGTCGAGGAT
GGCCAGACCGTGAGGATGCCTGTGGGAAAAAGGGAAATTTTCATTACGTTCAGGGTGCAGAAAAGCCCT
GTGTTCCGGAGGGACGGCGCAGACATCCACTCCGACCTCTTTATTTCTATAGCTCAGGCTCTTCTTGGG
GGTACAGCCAGAGCCCAGGGCCTGTACGAGACGATCAACGTGACGATCCCCCCTGGGACTCAGACAGAC
CAGAAGATTCGGATGGGTGGGAAAGGCATCCCCCGGATTAACAGCTACGGCTACGGAGACCACTACATC
CACATCAAGATACGAGTTCCAAAGAGGCTAACGAGCCGGCAGCAGAGCCTGATCCTGAGCTACGCCGAG
GACGAGACAGATGTGGAGGGGACGGTGAACGGCGTCACCCTCACCAGCTCTGGAAAAAGATCCACTGGA
AACTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001286516
Insert Size 903 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001286516.1
RefSeq Size 2314 bp
RefSeq ORF 903 bp
Locus ID 9093
UniProt ID Q96EY1
MW 33.1 kDa
Gene Summary This gene encodes a member of the DNAJ/Hsp40 protein family. DNAJ/Hsp40 proteins stimulate the ATPase activity of Hsp70 chaperones and play critical roles in protein folding, degradation, and multimeric complex assembly. The encoded protein is localized to mitochondria and mediates several cellular processes including proliferation, survival and apoptotic signal transduction. The encoded protein also plays a critical role in tumor suppression through interactions with oncogenic proteins including ErbB2 and the p53 tumor suppressor protein. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (3) lacks a segment in the 5' end and an alternate exon in the 3' end compared to variant 1. The resulting isoform (3) has shorter and distinct N- and C-termini compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...