Sprouty 4 (SPRY4) (NM_001293290) Human Untagged Clone

CAT#: SC335186

SPRY4 (untagged) - Human sprouty homolog 4 (Drosophila) (SPRY4), transcript variant 4



  "NM_001293290" in other vectors (2)

CN¥ 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00


SPRY4 rabbit polyclonal antibody
    • 25 ul

CN¥ 800.00
CN¥ 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HH17
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335186 representing NM_001293290.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGCCCCCGATCCCACAGAGCGCCCCCTTGACTCCCAACTCAGTCATGGTCCAGCCCCTTCTTGAC
AGCCGGATGTCCCACAGCCGGCTCCAGCACCCACTCACCATCCTACCCATTGACCAGGTGAAGACCAGC
CATGTGGAGAATGACTACATAGACAACCCTAGCCTGGCCCTGACCACCGGCCCAAAGCGGACCCGGGGC
GGGGCCCCAGAGCTGGCCCCGACGCCCGCCCGCTGTGACCAGGATGTCACCCACCATTGGATCTCCTTC
AGCGGGCGCCCCAGCTCTGTGAGCAGCAGCAGCAGCACATCCTCTGACCAACGGCTCTTAGACCACATG
GCACCACCACCCGTGGCTGACCAGGCCTCACCAAGGGCTGTGCGCATCCAGCCCAAGGTGGTCCACTGC
CAGCCGCTGGACCTCAAGGGCCCGGCGGTCCCACCCGAGCTGGACAAGCACTTCTTGCTGTGCGAGGCC
TGTGGGAAGTGTAAATGCAAGGAGTGTGCATCCCCCCGGACGTTGCCTTCCTGCTGGGTCTGCAACCAG
GAGTGCCTGTGCTCAGCCCAGACTCTGGTCAACTATGGCACGTGCATGTGTTTGGTGCAGGGCATCTTC
TACCACTGCACGAATGAGGACGATGAGGGCTCCTGCGCTGACCACCCCTGCTCCTGCTCCCGCTCCAAC
TGCTGCGCCCGCTGGTCCTTCATGGGTGCTCTCTCCGTGGTGCTGCCCTGCCTGCTCTGCTACCTGCCT
GCCACCGGCTGCGTGAAGCTGGCCCAGCGTGGCTACGACCGTCTGCGCCGCCCTGGTTGCCGCTGCAAG
CACACGAACAGCGTCATCTGCAAAGCAGCCAGCGGGGATGCCAAGACCAGCAGGCCCGACAAGCCTTTC
TGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001293290
Insert Size 900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001293290.1
RefSeq Size 5257 bp
RefSeq ORF 900 bp
Locus ID 81848
UniProt ID Q9C004
Protein Pathways Jak-STAT signaling pathway
MW 32.5 kDa
Gene Summary This gene encodes a member of a family of cysteine- and proline-rich proteins. The encoded protein is an inhibitor of the receptor-transduced mitogen-activated protein kinase (MAPK) signaling pathway. Activity of this protein impairs the formation of active GTP-RAS. Nucleotide variation in this gene has been associated with hypogonadotropic hypogonadism 17 with or without anosmia. Alternative splicing results in a multiple transcript variants. [provided by RefSeq, Jun 2014]
Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus than isoform 1. Variants 2, 3, and 4 encode the same isoform (2). Sequence Note: The RefSeq transcript was derived from the reference genome assembly. The genomic coordinates were determined from alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...