CDIN1 (NM_001290233) Human Untagged Clone

CAT#: SC335101

C15orf41 (untagged) - Human chromosome 15 open reading frame 41 (C15orf41), transcript variant 4



  "NM_001290233" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-C15orf41 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C15orf41; HH114
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001290233, the custom clone sequence may differ by one or more nucleotides


ATGATACTGACCAAAGCTCAGTACGACGAGATAGCCCAGTGCCTAGTGTCTGTGCCGCCTACCAGGCAGA
GCCTGAGGAAGCTGAAGCAGAGGTTTCCCAGTCAATCGCAGGCCACTCTGCTGAGCATCTTCTCCCAGGA
GTACCAGAAACACATTAAAAGAACACATGCCAAACATCATACTTCGGAAGCAATTGAAAGTTATTACCAG
AGGTACCTGAATGGAGTGGTGAAAAATGGAGCTGCCCCAGTGCTCCTGGACCTGGCCAATGAGGTGGACT
ATGCGCCCTCATTAATGGCTCGGCTTATACTGGAGAGGTTTCTACAGGAACACGAGGAAACTCCACCCTC
CAAGTCTATTATAAATAGTATGCTACGGGACCCTTCTCAGATTCCAGATGGAGTTCTAGCAAATCAGGTC
TATCAGTGCATTGTGAACGACTGCTGTTACGGACCACTAGTGGACTGCATCAAGCATGCCATTGGTCATG
AGCATGAGGTCCTGCTGAGAGACTTGCTTCTAGAGAAAAACCTGTCCTTCCTAGATGAAGATCAGCTTCG
TGCAAAGGGTTATGACAAAACACCAGACTTCATTTTACAAGTACCAGTTGCTGTAGAAGGGCACATAATT
CACTGGATTGAAAGCAAAGCCTCATTTGGTGATGAATGTAGCCACCACGCCTACCTGCATGACCAGTTCT
GGAGCTACTGGAATAGAGATGGGATCTCACAATGTTCCTCAGGCTGGTGTGGAACTCCTGGGCTCAGCGA
TTCTTCTGCCTCAGCCACCCAAAGTGCTGGAATTACAGGAGCGAGGAAACATTTTCTACCAGGAATCTTT
ATGAAATGTGTTTGTAAATAA


Restriction Sites SgfI-MluI     
ACCN NM_001290233
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001290233.1, NP_001277162.1
RefSeq Size 1281 bp
RefSeq ORF 861 bp
Locus ID 84529
UniProt ID Q9Y2V0
Gene Summary This gene encodes a protein with two predicted helix-turn-helix domains. Mutations in this gene were found in families with congenital dyserythropoietic anemia type Ib. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Transcript Variant: This variant (4) lacks multiple 3' exons and contains an alternate 3' terminal exon, resulting in a different 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (3) has a distinct C-temrinus and is longer than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...