RPA34 (RPA2) (NM_001297558) Human Untagged Clone
CAT#: SC335015
RPA2 (untagged) - Human replication protein A2, 32kDa (RPA2), transcript variant 3
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
RPA2 mouse monoclonal antibody, clone OTI9A1 (formerly 9A1)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | REPA2; RP-A p32; RP-A p34; RPA32 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001297558, the custom clone sequence may differ by one or more nucleotides
ATGGGCAGAGGAGACAGGAACAAGCGTAGCATCCGTGGATTCGAAAGCTATGGCAGCTCCTCATACGGGG GAGCCGGCGGCTACACGCAGTCCCCGGGGGGCTTTGGATCGCCCGCACCTTCTCAAGCCGAAAAGAAATC AAGAGCCCGAGCCCAGCACATTGTGCCCTGTACTATATCTCAGCTGCTTTCTGCCACTTTGGTTGATGAA GTGTTCAGAATTGGGAATGTTGAGATTTCACAGGTCACTATTGTGGGGATCATCAGACATGCAGAGAAGG CTCCAACCAACATTGTTTACAAAATAGATGACATGACAGCTGCACCCATGGACGTTCGCCAGTGGGTTGA CACAGATGACACCAGCAGTGAAAACACTGTGGTTCCTCCAGAAACATATGTGAAAGTGGCAGGCCACCTG AGATCTTTTCAGAACAAAAAGAGCCTGGTAGCCTTTAAGATCATGCCCCTGGAGGATATGAATGAGTTCA CCACACATATTCTGGAAGTGATCAATGCACACATGGTACTAAGCAAAGCCAACAGCCAGCCCTCAGCAGG GAGAGCACCTATCAGCAATCCAGGAATGAGTGAAGCAGGGAACTTTGGTGGGAATAGCTTCATGCCAGCA AATGGCCTCACTGTGGCCCAAAACCAGGTGTTGAATTTGATTAAGGCTTGTCCAAGACCTGAAGGGTTGA ACTTTCAGGATCTCAAGAACCAGCTGAAACACATGTCTGTATCCTCAATCAAGCAAGCTGTGGATTTTCT GAGCAATGAGGGGCACATCTATTCTACTGTGGATGATGACCATTTTAAATCCACAGATGCAGAATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001297558 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001297558.1, NP_001284487.1 |
RefSeq Size | 1626 bp |
RefSeq ORF | 837 bp |
Locus ID | 6118 |
UniProt ID | P15927 |
Protein Families | Druggable Genome, Stem cell - Pluripotency |
Protein Pathways | DNA replication, Homologous recombination, Mismatch repair, Nucleotide excision repair |
Gene Summary | This gene encodes a subunit of the heterotrimeric Replication Protein A (RPA) complex, which binds to single-stranded DNA (ssDNA), forming a nucleoprotein complex that plays an important role in DNA metabolism, being involved in DNA replication, repair, recombination, telomere maintenance, and co-ordinating the cellular response to DNA damage through activation of the ataxia telangiectasia and Rad3-related protein (ATR) kinase. The RPA complex protects single-stranded DNA from nucleases, prevents formation of secondary structures that would interfere with repair, and co-ordinates the recruitment and departure of different genome maintenance factors. The heterotrimeric complex has two different modes of ssDNA binding, a low-affinity and high-affinity mode, determined by which oligonucleotide/oligosaccharide-binding (OB) domains of the complex are utilized, and differing in the length of DNA bound. This subunit contains a single OB domain that participates in high-affinity DNA binding and also contains a winged helix domain at its carboxy terminus, which interacts with many genome maintenance protein. Post-translational modifications of the RPA complex also plays a role in co-ordinating different damage response pathways. [provided by RefSeq, Sep 2017] Transcript Variant: This variant (3) uses an alternate splice site in the 5' region and initiates translation at an alternate upstream start codon, compared to variant 1. The encoded isoform (3) has a distinct N-terminus and is longer than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...