LSP1 (NM_001289005) Human Untagged Clone

CAT#: SC335003

LSP1 (untagged) - Human lymphocyte-specific protein 1 (LSP1), transcript variant 6



  "NM_001289005" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal LSP1 Antibody
    • 100 ug

CNY 5,302.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms pp52; WP34
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001289005, the custom clone sequence may differ by one or more nucleotides


ATGCTCCTCAGCCTGAAGCCCTCGGAGGCCCCTGAACTGGATGAGGACGAGGGCTTTGGCGACTGGTCCC
AGAGGCCAGAGCAGCGGCAGCAGCACGAGGGGGCGCAGGGCGCCTTGGACAGCGGAGAGCCCCCCCAGTG
CAGGAGTCCTGAGGGGGAGCAAGAGGACAGGCCCGGCCTGCATGCCTACGAAAAGGAGGACAGTGATGAA
GTCCACCTGGAGGAGTTGAGTCTGAGCAAGGAGGGGCCAGGCCCAGAGGACACTGTCCAGGACAACCTGG
GGGCCGCAGGGGCTGAGGAGGAACAGGAGGAGCACCAGAAATGTCAGCAGCCCAGGACACCCAGCCCCTT
GGTCTTGGAGGGGACCATCGAACAGAGCTCGCCTCCCCTGAGCCCTACCACCAAACTCATCGACAGGACC
GAGTCCCTAAACCGCTCCATAGAGAAGAGTAACAGTGTGAAGAAATCCCAGCCAGACTTGCCCATCTCCA
AGATTGATCAGTGGCTGGAACAATACACCCAGGCCATCGAGACCGCTGGCCGGACCCCCAAGCTAGCCCG
CCAGGCCTCCATAGAGCTGCCCAGCATGGCTGTGGCCAGTACCAAGAGTCGGTGGGAGACGGGTGAGGTA
CAGGCTCAGTCTGCGGCCAAGACTCCGTCCTGCAAGGATATTGTGGCTGGAGACATGAGCAAGAAAAGCC
TCTGGGAGCAGAAGGGAGGCTCCAAGACCTCATCAACAATTAAGAGCACCCCATCTGGGAAGAGGTATAA
GTTTGTGGCCACCGGGCATGGGAAGTATGAGAAGGTGCTTGTGGAAGGGGGCCCGGCTCCCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001289005
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001289005.1, NP_001275934.1
RefSeq Size 1882 bp
RefSeq ORF 834 bp
Locus ID 4046
UniProt ID P33241
Gene Summary This gene encodes an intracellular F-actin binding protein. The protein is expressed in lymphocytes, neutrophils, macrophages, and endothelium and may regulate neutrophil motility, adhesion to fibrinogen matrix proteins, and transendothelial migration. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (6) contains a distinct 5' UTR and lacks an in-frame portion of the 5' coding region, compared to variant 5. The resulting isoform (2) has a shorter N-terminus, compared to isoform 3. Variants 2, 3, 4 and 6 encode the same protein (isoform 2).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...