POLR3F (NM_001282526) Human Untagged Clone
CAT#: SC334983
POLR3F (untagged) - Human polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa (POLR3F), transcript variant 2
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C34; RPC6; RPC39 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001282526, the custom clone sequence may differ by one or more nucleotides
ATGCCTCATATAGAAGCCCAGCAGCGGGCAGTAGCCATCAATAGGTTGTTGTCTATGGGTCAGTTGGATC TCTTAAGGAGCAATACGGGCCTTTTATATAGAATAAAGGACTCTCAGAATGCTGGTAAAATGAAGGGATC CGATAACCAAGAAAAACTAGTATATCAAATCATAGAGGATGCAGGAAATAAAGGAATATGGAGCAGAGAT ATCCGCTATAAAAGTAATTTGCCATTAACAGAAATCAACAAAATTCTGAAGAATCTGGAAAGTAAAAAGC TTATCAAAGCTGTTAAGTCTGTAGCAGCCTCAAAAAAGAAGGTGTATATGCTCTATAACCTGCAGCCAGA CCGGTCTGTGACTGGTGGAGCCTGGTACAGTGACCAGGATTTTGAATCTGAATTTGTAGAGGTGCTTAAC CAACAGTGTTTTAAATTCCTACAGTCCAAGGCAGAAACAGCACGAGAAAGCAAACAGAACCCAATGATAC AAAGAAATAGTTCATTTGCCTCATCACATGAAGTGTGGAAATATATCTGCGAATTGGGAATCAGTAAGGT AGAGTTATCCATGGAAGACATTGAAACCATCCTGAATACACTCATTTATGATGGAAAAGTGGAGATGACG ATTATTGCTGCAAAAGAAGGCACAGTTGGCAGTGTAGATGGACACATGAAACTGTACAGGGCAGTCAATC CAATCATCCCTCCCACAGGTTTGGTCCGGGCACCCTGTGGACTCTGCCCGGTTTTTGATGACTGCCACGA AGGTGGTGAGATTTCACCATCTAACTGTATTTACATGACAGAGTGGCTCGAATTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282526 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001282526.1, NP_001269455.1 |
RefSeq Size | 2262 bp |
RefSeq ORF | 828 bp |
Locus ID | 10621 |
UniProt ID | Q9H1D9 |
Protein Families | Transcription Factors |
Protein Pathways | Cytosolic DNA-sensing pathway, Metabolic pathways, Purine metabolism, Pyrimidine metabolism, RNA polymerase |
Gene Summary | The protein encoded by this gene is one of more than a dozen subunits forming eukaryotic RNA polymerase III (RNA Pol III), which transcribes 5S ribosomal RNA and tRNA genes. This protein has been shown to bind both TFIIIB90 and TBP, two subunits of RNA polymerase III transcription initiation factor IIIB (TFIIIB). Unlike most of the other RNA Pol III subunits, the encoded protein is unique to this polymerase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013] Transcript Variant: This variant (2) differs in its 5' UTR and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237089 | POLR3F (myc-DDK-tagged) - Human polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa (POLR3F), transcript variant 2 |
CNY 3,990.00 |
|
RG237089 | POLR3F (tGFP-tagged) - Human polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa (POLR3F), transcript variant 2 |
CNY 4,370.00 |