TOMM40L (NM_001286373) Human Untagged Clone
CAT#: SC334977
TOMM40L (untagged) - Human translocase of outer mitochondrial membrane 40 homolog (yeast)-like (TOMM40L), transcript variant 2
CNY 2,950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | TOMM40B |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001286373, the custom clone sequence may differ by one or more nucleotides
ATGGGGAACACATTGGGCCTGGCACCAATGGGGACTTTGCCCCGCCGGAGCCCCCGCCGAGAGGAACCCC TGCCCAACCCTGGGAGCTTCGATGAGCTGCACCGTCTATGCAAAGATGTATTCCCAGCACAGATGGAGGG AGTGAAGCTCGTTGTCAACAAGGTTCTGAGCAGCCATTTCCAGGTGGCGCACACTATACACATGAGTGCC CTGGGCTTGCCGGGATATCACCTCCATGCGGCCTATGCAGGGGATTGGCAGCTCAGTCCCACTGAGACGC AGCAGGCCAAGTTCCTGACATGGCAGTTTGATGGCGAGTATCGGGGAGATGACTACACAGCCACTCTGAC CCTAGGAAATCCTGACCTGATTGGGGAGTCGGTGATCATGGTTGCTCACTTCCTGCAGAGCCTCACTCAT CGGCTGGTGCTGGGAGGAGAGCTAGTTTATCACCGGCGGCCAGGCGAAGAGGGGGCCATCTTGACACTGG CTGGGAAGTACTCGGCTGTACACTGGGTAGCTACATTGAATGTGGGATCAGGCGGGGCCCATGCAAGTTA CTACCACAGGGCAAATGAACAGGTTCAGGTTGGAGTGGAGTTTGAGGCAAACACAAGGCTACAAGACACA ACATTCTCCTTTGGTTACCACCTGACTCTGCCCCAGGCCAACATGGTATTTAGAGGCTTGGTGGATAGTA ACTGGTGTGTAGGTGCTGTGCTGGAGAAGAAGATGCCCCCTCTGCCTGTCACCCTAGCCCTTGGAGCCTT CCTCAATCACTGGCGCAACAGATTCCATTGTGGCTTCAGCATCACTGTGGGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001286373 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001286373.1, NP_001273302.1 |
RefSeq Size | 2825 bp |
RefSeq ORF | 825 bp |
Locus ID | 84134 |
UniProt ID | Q969M1 |
Protein Families | Druggable Genome, Ion Channels: Other |
Protein Pathways | Amyotrophic lateral sclerosis (ALS) |
Gene Summary | Potential channel-forming protein implicated in import of protein precursors into mitochondria.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an in-frame exon in the central coding region compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237083 | TOMM40L (myc-DDK-tagged) - Human translocase of outer mitochondrial membrane 40 homolog (yeast)-like (TOMM40L), transcript variant 2 |
CNY 3,990.00 |
|
RG237083 | TOMM40L (tGFP-tagged) - Human translocase of outer mitochondrial membrane 40 homolog (yeast)-like (TOMM40L), transcript variant 2 |
CNY 4,370.00 |
其它TOMM40L产品