RRP4 (EXOSC2) (NM_001282709) Human Untagged Clone
CAT#: SC334909
EXOSC2 (untagged) - Human exosome component 2 (EXOSC2), transcript variant 3
CN¥ 2,950.00
货期*
3周
规格
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | hRrp4p; p7; RRP4; Rrp4p; SHRF |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001282709, the custom clone sequence may differ by one or more nucleotides
ATGGCGATGGAGATGAGGCTTCCAGTGGCTCGCAAGCCTCTTAGCGAGAGACTGGGCCGCGACACTAAGA AACATCTAGTGGTGCCGGGGGATACAATCACTACGGACACAGGATTCATGCGGGGCCATGGAACGTATAT GGGAGAAGAGAAGCTCATTGCATCTGTTGCTGGCTCTGTGGAGAGAGTAAACAAGTTGATCTGTGTGAAA GCTTTGAAAACCAGATACATTGGTGAAGTAGGAGACATCGTAGTGGGACGAATCACAGAGAGGAGAAGAT CTGCAGAAGATGAGCTTGCAATGAGAGGTTTCTTACAGGAAGGGGACCTTATCAGTGCTGAGGTCCAGGC AGTGTTCTCTGACGGAGCTGTCTCTTTGCACACGAGGAGCCTGAAATATGGAAAACTAGGTCAGGGGGTT TTGGTCCAGGTTTCCCCCTCCCTGGTGAAACGGCAGAAGACCCACTTTCATGATTTGCCATGTGGTGCCT CAGTGATTCTCGGTAACAACGGCTTCATCTGGATTTACCCAACACCTGAGCACAAAGAAGAGGAAGCAGG GGGCTTCATTGCAAACCTGGAGCCTGTCTCTCTTGCTGATCGAGAGGTGATATCCCGGCTTCGGAACTGC ATCATCTCGCTGGTAACTCAGAGGATGATGCTGTATGATACCAGCATCCTGTACTGCTATGAAGCATCCC TTCCACATCAGATCAAAGACATCTTAAAGCCAGAAATAATGGAGGAGATTGTGATGGAAACACGCCAGAG GCTTTTGGAACAGGAGGGATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282709 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001282709.1, NP_001269638.1 |
RefSeq Size | 1944 bp |
RefSeq ORF | 792 bp |
Locus ID | 23404 |
UniProt ID | Q13868 |
Protein Pathways | RNA degradation |
Gene Summary | Non-catalytic component of the RNA exosome complex which has 3'->5' exoribonuclease activity and participates in a multitude of cellular RNA processing and degradation events. In the nucleus, the RNA exosome complex is involved in proper maturation of stable RNA species such as rRNA, snRNA and snoRNA, in the elimination of RNA processing by-products and non-coding 'pervasive' transcripts, such as antisense RNA species and promoter-upstream transcripts (PROMPTs), and of mRNAs with processing defects, thereby limiting or excluding their export to the cytoplasm. The RNA exosome may be involved in Ig class switch recombination (CSR) and/or Ig variable region somatic hypermutation (SHM) by targeting AICDA deamination activity to transcribed dsDNA substrates. In the cytoplasm, the RNA exosome complex is involved in general mRNA turnover and specifically degrades inherently unstable mRNAs containing AU-rich elements (AREs) within their 3' untranslated regions, and in RNA surveillance pathways, preventing translation of aberrant mRNAs. It seems to be involved in degradation of histone mRNA. The catalytic inactive RNA exosome core complex of 9 subunits (Exo-9) is proposed to play a pivotal role in the binding and presentation of RNA for ribonucleolysis, and to serve as a scaffold for the association with catalytic subunits and accessory proteins or complexes. EXOSC2 as peripheral part of the Exo-9 complex stabilizes the hexameric ring of RNase PH-domain subunits through contacts with EXOSC4 and EXOSC7.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) lacks an alternate in-frame exon in the central coding region compared to variant 1. It encodes isoform 3 which is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...